Difference between revisions of "Phosphatase GeneID AqueP159"

From PhosphataseWiki
Jump to: navigation, search
(Created page with "=== AqueP159, AqueP160, AqueP161: redundant? === AqueP159 is updated and one residue longer than [http://metazoa.ensembl.org/Amphimedon_queenslandica/Gene/Summary?db=core;g=Aq...")
 
 
Line 1: Line 1:
 
=== AqueP159, AqueP160, AqueP161: redundant? ===
 
=== AqueP159, AqueP160, AqueP161: redundant? ===
−
AqueP159 is updated and one residue longer than [http://metazoa.ensembl.org/Amphimedon_queenslandica/Gene/Summary?db=core;g=Aqu1.210066;r=Contig12601:26303-26448;t=PAC:15708594;tl=PfOgZb3yiZR6ToRv-2132434-42902643 Aqu1.210066 (PAC:15708594)].
+
AqueP159 is updated and one residue longer than [http://metazoa.ensembl.org/Amphimedon_queenslandica/Gene/Summary?db=core;g=Aqu1.210066;r=Contig12601:26303-26448;t=PAC:15708594;tl=PfOgZb3yiZR6ToRv-2132434-42902643 Aqu1.210066 (PAC:15708594)]. By BLASTNing the genomic sequence against sponge genome in Ensemblgenomes.org, the best hit except itself is 98.6% identity and overlaps with the region encoding AqueP161, i.e. [http://metazoa.ensembl.org/Amphimedon_queenslandica/Gene/Summary?db=core;g=Aqu1.219849;r=Contig13380:149683-152215;t=PAC:15718377;tl=m5wWoi1EVo0CcjBw-2132436-42902660 Aqu1.219849 (PAC:15718377)] on Contig13380. We currently annotate AqueP160 as a gene different from AqueP161 and AqueP160.
  
−
AqueP160 is a new gene model predicted from a short contig Contig110 (only 870 bp). By BLASTNing the genomic sequence against sponge genome in Ensemblgenomes.org, the best hit except itself is 98.6% identity and overlaps with the region encoding AqueP161, i.e. [http://metazoa.ensembl.org/Amphimedon_queenslandica/Gene/Summary?db=core;g=Aqu1.219849;r=Contig13380:149683-152215;t=PAC:15718377;tl=m5wWoi1EVo0CcjBw-2132436-42902660 Aqu1.219849 (PAC:15718377)] on Contig13380. We currently annotate AqueP160 as a gene different from AqueP161 and AqueP159.
 
  
−
>Contig110 dna:scaffold scaffold:Aqu1:Contig110:716:840:1
+
>AqueP159_genomic Contig12601 dna:scaffold scaffold:Aqu1:Contig12601:26303:26448:1
 +
TCACCATAAAGACTGCTGGTGTAAGTTTCGACTCAGAACCGAGCGGACATCTTGCGTGAA
 +
TCTCAGCGAATCTAAAAATGGTAAGAGATCAAGCAAGTCCGTATCAAGAGGGTCTGAGAA
 +
CCACGAGGTTATCGGAATAGCATTGT
 +
 
 +
 
 +
AqueP160 is a new gene model predicted from a short contig Contig110 (only 870 bp). By BLASTNing the genomic sequence against sponge genome in Ensemblgenomes.org, the best hit except itself is 98.6% identity and overlaps with the region encoding AqueP161, i.e. [http://metazoa.ensembl.org/Amphimedon_queenslandica/Gene/Summary?db=core;g=Aqu1.219849;r=Contig13380:149683-152215;t=PAC:15718377;tl=m5wWoi1EVo0CcjBw-2132436-42902660 Aqu1.219849 (PAC:15718377)] on Contig13380. We currently annotate AqueP160 as a gene different from AqueP161 and AqueP159.
 +
 
 +
However, we cannot exclude AqueP159 and AqueP160 is encoded by the same gene, because i) they are different part of DULLARD in protein sequence, that is why their protein and genomic sequences do not overlap with each other, ii) we cannot build longer gene models from the two contigs Contig12601 and Contig110. Contig12601 is 26501 bp long and has two long regions of gaps; Contig110 is very short 870 bp.
 +
 
 +
>AqueP160_genomic Contig110 dna:scaffold scaffold:Aqu1:Contig110:716:840:1
 
CTGACCAGGATTTCCCCTATAAGCTGAAGGTGAATTATCAAGTATAAAAATGTTGCTAAG
 
CTGACCAGGATTTCCCCTATAAGCTGAAGGTGAATTATCAAGTATAAAAATGTTGCTAAG
 
ATCTTCACTTATCATTGAGAGATTCTTAGTGTAGCCATTCATATCCATCGTACAGTCCTT
 
ATCTTCACTTATCATTGAGAGATTCTTAGTGTAGCCATTCATATCCATCGTACAGTCCTT
 
GAGAG
 
GAGAG
 +
  
 
AqueP161 is identical to [http://metazoa.ensembl.org/Amphimedon_queenslandica/Gene/Summary?db=core;g=Aqu1.219849;r=Contig13380:149683-152215;t=PAC:15718377;tl=m5wWoi1EVo0CcjBw-2132436-42902660 Aqu1.219849 (PAC:15718377)].
 
AqueP161 is identical to [http://metazoa.ensembl.org/Amphimedon_queenslandica/Gene/Summary?db=core;g=Aqu1.219849;r=Contig13380:149683-152215;t=PAC:15718377;tl=m5wWoi1EVo0CcjBw-2132436-42902660 Aqu1.219849 (PAC:15718377)].

Latest revision as of 19:45, 30 September 2015

AqueP159, AqueP160, AqueP161: redundant?

AqueP159 is updated and one residue longer than Aqu1.210066 (PAC:15708594). By BLASTNing the genomic sequence against sponge genome in Ensemblgenomes.org, the best hit except itself is 98.6% identity and overlaps with the region encoding AqueP161, i.e. Aqu1.219849 (PAC:15718377) on Contig13380. We currently annotate AqueP160 as a gene different from AqueP161 and AqueP160.


>AqueP159_genomic Contig12601 dna:scaffold scaffold:Aqu1:Contig12601:26303:26448:1 TCACCATAAAGACTGCTGGTGTAAGTTTCGACTCAGAACCGAGCGGACATCTTGCGTGAA TCTCAGCGAATCTAAAAATGGTAAGAGATCAAGCAAGTCCGTATCAAGAGGGTCTGAGAA CCACGAGGTTATCGGAATAGCATTGT


AqueP160 is a new gene model predicted from a short contig Contig110 (only 870 bp). By BLASTNing the genomic sequence against sponge genome in Ensemblgenomes.org, the best hit except itself is 98.6% identity and overlaps with the region encoding AqueP161, i.e. Aqu1.219849 (PAC:15718377) on Contig13380. We currently annotate AqueP160 as a gene different from AqueP161 and AqueP159.

However, we cannot exclude AqueP159 and AqueP160 is encoded by the same gene, because i) they are different part of DULLARD in protein sequence, that is why their protein and genomic sequences do not overlap with each other, ii) we cannot build longer gene models from the two contigs Contig12601 and Contig110. Contig12601 is 26501 bp long and has two long regions of gaps; Contig110 is very short 870 bp.

>AqueP160_genomic Contig110 dna:scaffold scaffold:Aqu1:Contig110:716:840:1 CTGACCAGGATTTCCCCTATAAGCTGAAGGTGAATTATCAAGTATAAAAATGTTGCTAAG ATCTTCACTTATCATTGAGAGATTCTTAGTGTAGCCATTCATATCCATCGTACAGTCCTT GAGAG


AqueP161 is identical to Aqu1.219849 (PAC:15718377).

Retrieved from "http://phosphatome.net/wiki/index.php?title=Phosphatase_GeneID_AqueP159&oldid=3044"