Difference between revisions of "Phosphatase GeneID AqueP159"
From PhosphataseWiki
(Created page with "=== AqueP159, AqueP160, AqueP161: redundant? === AqueP159 is updated and one residue longer than [http://metazoa.ensembl.org/Amphimedon_queenslandica/Gene/Summary?db=core;g=Aq...") |
(No difference)
|
Revision as of 19:32, 30 September 2015
AqueP159, AqueP160, AqueP161: redundant?
AqueP159 is updated and one residue longer than Aqu1.210066 (PAC:15708594).
AqueP160 is a new gene model predicted from a short contig Contig110 (only 870 bp). By BLASTNing the genomic sequence against sponge genome in Ensemblgenomes.org, the best hit except itself is 98.6% identity and overlaps with the region encoding AqueP161, i.e. Aqu1.219849 (PAC:15718377) on Contig13380. We currently annotate AqueP160 as a gene different from AqueP161 and AqueP159.
>Contig110 dna:scaffold scaffold:Aqu1:Contig110:716:840:1 CTGACCAGGATTTCCCCTATAAGCTGAAGGTGAATTATCAAGTATAAAAATGTTGCTAAG ATCTTCACTTATCATTGAGAGATTCTTAGTGTAGCCATTCATATCCATCGTACAGTCCTT GAGAG
AqueP161 is identical to Aqu1.219849 (PAC:15718377).
